cgratz2245 cgratz2245

10-07-2024
Biology

Answered

A newly-synthesized transcript has the sequence UUGCACGGAUGCCUUUGGCCA. What was the sequence of the template strand used in the synthesis of this transcript?
A. UGGCCAAAGGCAUCCUGCAA
B. TGGCCAAAGGCATCCTGCAA
C. TTGCACGGAUGCCTTTGGCCA
D. UUGCACGGAUGCCUUUGGCCA

Answer :

Other Questions

A point M on a segment with endpoints X (1, -2) and Y (10, 3) partitions the segment in a 5:1 ratio. Find M.

Which of the following is NOT one of the innovations of Ivy Lee?A. Emphasize good stories during bad circumstancesB. More openness with the pressC. Truth in adv

Question 24 of 25Which of the following is a characteristic of a strong base?A. It is more concentrated than a weak base.B. It contributes [tex]\(H^+\)[/tex] io

A sequence of numbers begins with 12 and progresses geometrically. Each number is the previous number divided by 2.Which value can be used as the common ratio i

Which parenting style rewards children for following the rules?A. AuthoritativeB. AuthoritarianC. PermissiveD. Neglectful

Select the correct answer.Consider functions [tex]\( f \)[/tex] and [tex]\( g \)[/tex]:[tex]\[ f(x) = x^3 + 5x^2 - x \][/tex][tex]\[ \begin{tabular}{|c|c|c|c|c|

Cho hình chữ nhật ABCD có AD=2AB . Lấy điểm M bất kì trên cạnh BC. Đường thẳng AM cắt CD tại P. CMR: 1/AB^2=1/AM^2+1/AP^2

In a bicameral legislature, a bill needs to be passed by both the House and the Senate before it is sent to the governor to be signed into law.TrueFalse

Let [tex](-5, -3)[/tex] be a point on the terminal side of [tex]\theta[/tex].Find the exact values of [tex]\sin \theta[/tex], [tex]\sec \theta[/tex], and [tex]\

Use washers to find the volume formed by rotating the region enclosed by:[tex]\[ y = 1.8 - 0.4|x - 1.5| \][/tex]and[tex]\[ y = 0 \][/tex]about the [tex]\( y \)[

How do I solve this equation? If 3t-7=5t then 6t=a 21b-7c-21d-42

a gasoline pump delivers 4 2/5 gallons of gas per minute. how many minutes will it take to fill a gas tank that holds 16 1/2 gallons?

What is the volume of a rectangular box that has base area of 75 square inches and a height of 20 inches

Why did the settlers go to new mexico during manifest destiny?

anita tosses 3 coins. what is the probability that all the coins will land tails up?

Hinge Joints-These jointscan only move in one direction, like a door hinge. One bone works against another. Movement is back and forth on one plane.Examples:___

Slope= 1/5, y-intercept=1

Why didn't the first stars to form have solar systems with Earth like planets and satellites?

what percent of 126 is 22?

What does compris mean in French ???